Lysin motif (LysM)-containing proteins (LYPs) are important pattern recognition receptors in plants. However, the evolutionary history and characteristics of LYP genes remain largely unclear in wheat. In this study, 62 LYPs were identified at genome wide in wheat. Based on phylogenetic and domain analysis, wheat LYPs were classified into 6 subgroups (group LysMe, LysMn, LYP, LYK, LysMFbox). Syntenic analysis showed the evolution of LYP genes in wheat. RNA-seq data showed that 22 genes were not expressed at any tissue or stress stimulation period. Some
Plants are subjected to a wide range of stresses which reduces and limits the productivity of agricultural crops [
Lysin motif (LysM), usually about 40 amino acids, is a widely distributed protein motif in prokaryotes and eukaryotes [
Wheat (
Wheat coding sequence (CDS), and functional annotations of wheat genes were downloaded from IWGSC archive v.1.1 (
Protein sequences of
We suggest a consistent naming pattern for all LysM genes, considering of their subgroup, phylogenetic relationships, motif contained as well as their subgenome location (A, B or D). Each gene name starts with an abbreviation of
The genome annotation information of wheat was used to analyzed the chromosomal localization. The local blast searches of wheat and itself was conducted for considerable pairs of homologous genes. Then TBtools was employed to perform synteny analysis. Ka, Ks, and Ka/Ks values of wheat LYP gene pairs were calculated [
Expression level was downloaded from Wheat Expression Browser (
The relative expression levels of the A, B and D subgenome were analyzed only when the gene triads across the three subgenomes comply with 1:1:1. To standardize the relative expression of each homolog across the triad, we normalized the absolute tpm to the expression ratio of three subgenome. The tenary diagram was plotted by R package ggtern [
For qRT-PCR, wheat leaves inoculated with
A total of 65 coding sequences were identified by HMM search using HMM profile (PF01476) in IWGSC wheat genome (
Gene Id | Gene name | Chr1 | Start2 | End3 | strand | Prot(aa)4 | Exon | TargetP5 | TMH6 | pI7 | MW (kDa)8 | GRAVY9 |
---|---|---|---|---|---|---|---|---|---|---|---|---|
TraesCS3B02G352100.1 | TaLysMe1-3B1 | 3B | 561840722 | 561841388 | + | 101 | 2 | SP | 1 | 5.56 | 10.3659 | 0.547 |
TraesCS3B02G351900.1 | TaLysMe1-3B2 | 3B | 561592592 | 561592992 | + | 101 | 2 | SP | 1 | 5.56 | 10.33789 | 0.552 |
TraesCS3A02G314900.1 | TaLysMe2-3A | 3A | 556340109 | 556340688 | − | 103 | 2 | SP | 1 | 6.52 | 10.64526 | 0.503 |
TraesCS3A02G315000.1 | TaLysMe3-3A1 | 3A | 556353562 | 556353963 | − | 102 | 2 | SP | 1 | 5 | 10.50808 | 0.520 |
TraesCS3D02G316500.1 | TaLysMe1-3D | 3D | 429637289 | 429637682 | + | 102 | 2 | SP | 1 | 5.56 | 10.43901 | 0.579 |
TraesCS3A02G314800.1 | TaLysMe3-3A2 | 3A | 556260455 | 556260849 | − | 101 | 2 | SP | 1 | 5.04 | 10.49296 | 0.362 |
TraesCS3B02G352200.1 | TaLysMe3-3B | 3B | 561889196 | 561889667 | + | 102 | 2 | SP | 1 | 5.61 | 10.66622 | 0.368 |
TraesCS3D02G316600.1 | TaLysMe3-3D | 3D | 429647452 | 429648203 | + | 102 | 2 | SP | 1 | 5.04 | 10.60612 | 0.421 |
TraesCS3A02G316100.1 | TaLysMe5-3A | 3A | 556683215 | 556683592 | + | 125 | 1 | SP | 1 | 6.68 | 13.07622 | 0.569 |
TraesCS3D02G315300.1 | TaLysMe5-3D | 3D | 428993996 | 428994373 | − | 125 | 1 | SP | 1 | 6.22 | 12.95703 | 0.526 |
TraesCS3B02G350800.1 | TaLysMe5-3B | 3B | 561038700 | 561039083 | − | 100 | 2 | SP | 1 | 6 | 10.31383 | 0.461 |
TraesCS3D02G315500.1 | TaLysMe4-3D1 | 3D | 429085177 | 429085783 | − | 104 | 2 | SP | 1 | 5.55 | 10.63323 | 0.540 |
TraesCS3D02G315400.1 | TaLysMe4-3D2 | 3D | 429043817 | 429044231 | − | 101 | 2 | SP | 1 | 6.69 | 10.33991 | 0.501 |
TraesCS3B02G350900.1 | TaLysMe4-3B | 3B | 561044324 | 561044733 | − | 101 | 2 | SP | 1 | 6.69 | 10.32589 | 0.505 |
TraesCS3A02G316000.1 | TaLysMe4-3A | 3A | 556678445 | 556678976 | + | 101 | 2 | SP | 1 | 6.68 | 10.31186 | 0.498 |
TraesCS4B02G038000.1 | TaLysMFbox-4B | 4B | 27526533 | 27528622 | − | 245 | 2 | OTHER | 0 | 8.86 | 26.88542 | −0.342 |
TraesCS4A02G275700.1 | TaLysMFbox-4A | 4A | 584671905 | 584675986 | + | 248 | 2 | OTHER | 0 | 9.29 | 27.21388 | −0.338 |
TraesCS4D02G035300.1 | TaLysMFbox-4D | 4D | 15927016 | 15929136 | − | 245 | 2 | OTHER | 0 | 8.5 | 26.91644 | −0.371 |
TraesCS5A02G347800.1 | TaLYP1-5A | 5A | 550718922 | 550721627 | + | 366 | 4 | SP | 0 | 8.28 | 37.68609 | 0.245 |
TraesCS5B02G348800.1 | TaLYP1-5B | 5B | 530262150 | 530264999 | + | 366 | 4 | SP | 0 | 8.28 | 37.71809 | 0.230 |
TraesCS5D02G354000.1 | TaLYP1-5D | 5D | 436257553 | 436260258 | + | 370 | 4 | SP | 0 | 8.28 | 38.05448 | 0.226 |
TraesCS4B02G329500.2 | TaLYP2-4B | 4B | 620056284 | 620059068 | + | 356 | 4 | SP | 0 | 7.83 | 37.10154 | 0.118 |
TraesCS4D02G326400.2 | TaLYP2-4D | 4D | 486179743 | 486183283 | − | 360 | 4 | SP | 0 | 8.09 | 37.66021 | 0.159 |
TraesCS5A02G501100.1 | TaLYP2-5A | 5A | 666740738 | 666743746 | + | 418 | 4 | OTHER | 0 | 8.98 | 43.58167 | −0.045 |
TraesCS5A02G234700.1 | TaLYP3-5A | 5A | 451012317 | 451015052 | + | 411 | 5 | SP | 0 | 5.81 | 41.44488 | 0.443 |
TraesCS5B02G233200.1 | TaLYP3-5B | 5B | 411544324 | 411547275 | + | 410 | 5 | SP | 1 | 6.04 | 41.74732 | 0.427 |
TraesCS5D02G241600.1 | TaLYP3-5D | 5D | 350592971 | 350595725 | + | 406 | 5 | SP | 0 | 5.56 | 41.3397 | 0.451 |
TraesCS7B02G073300.1 | TaLYP4-7B | 7B | 81690952 | 81694741 | + | 401 | 5 | SP | 1 | 4.73 | 39.99348 | 0.417 |
TraesCS7D02G169400.1 | TaLYP4-7D | 7D | 120321447 | 120325549 | + | 401 | 5 | SP | 1 | 4.57 | 39.96637 | 0.419 |
TraesCS7A02G168500.1 | TaLYP4-7A | 7A | 125262698 | 125266532 | + | 401 | 5 | SP | 1 | 4.57 | 39.92531 | 0.425 |
TraesCS6B02G359500.1 | TaLYP5-6B1 | 6B | 631200466 | 631203676 | − | 420 | 5 | SP | 0 | 5.25 | 42.36345 | 0.336 |
TraesCS6A02G328800.1 | TaLYP5-6A | 6A | 562374700 | 562378122 | − | 460 | 5 | luTP | 0 | 5.68 | 46.78852 | 0.288 |
TraesCS6B02G359300.1 | TaLYP5-6B2 | 6B | 630846675 | 630849877 | + | 420 | 5 | SP | 0 | 5.37 | 42.37548 | 0.342 |
TraesCS6D02G307700.1 | TaLYP5-6D | 6D | 418739676 | 418742695 | − | 423 | 5 | SP | 0 | 5.12 | 42.73099 | 0.362 |
TraesCS4B02G353400.1 | TaEMSA1-4B | 4B | 645084113 | 645084496 | − | 127 | 1 | OTHER | 1 | 6.27 | 13.48821 | −0.154 |
TraesCS4D02G347400.1 | TaEMSA1-4D | 4D | 501233795 | 501234169 | − | 124 | 1 | SP | 1 | 6.05 | 13.2852 | −0.031 |
TraesCS1B02G195500.1 | TaEMSA2-1B | 1B | 350630695 | 350631492 | − | 116 | 1 | SP | 0 | 5.75 | 12.27492 | −0.028 |
TraesCS1A02G187700.1 | TaEMSA2-1A | 1A | 338600466 | 338600819 | − | 117 | 1 | SP | 0 | 5.48 | 12.32601 | 0.015 |
TraesCS1D02G188900.1 | TaEMSA2-1D | 1D | 261373559 | 261373912 | + | 117 | 1 | SP | 0 | 5.75 | 12.37002 | −0.047 |
TraesCS7B02G486800.1 | TaLysMn1-7B | 7B | 742588952 | 742591716 | + | 333 | 3 | OTHER | 0 | 9.02 | 35.59269 | −0.596 |
TraesCS7D02G549400.1 | TaLysMn1-7D | 7D | 634175263 | 634178042 | + | 328 | 3 | OTHER | 0 | 8.35 | 35.01197 | −0.636 |
TraesCS7A02G560400.1 | TaLysMn1-7A | 7A | 732087221 | 732090195 | + | 327 | 3 | OTHER | 0 | 7.75 | 34.97595 | −0.603 |
TraesCS3B02G588200.1 | TaLYK3-3B | 3B | 814266347 | 814274743 | − | 593 | 4 | SP | 0 | 8.23 | 65.83633 | −0.154 |
TraesCSU02G125700.1 | TaLYK3-U | Un | 108652929 | 108662267 | + | 550 | 5 | SP | 0 | 8.11 | 61.00381 | −0.217 |
TraesCS5A02G552200.1 | TaLYK3-5A | 5A | 705361926 | 705376743 | − | 593 | 3 | SP | 0 | 8.8 | 65.73226 | −0.166 |
TraesCS3B02G403100.1 | TaLYK1-3B | 3B | 637076174 | 637079536 | + | 615 | 10 | SP | 2 | 6.05 | 68.27747 | −0.043 |
TraesCS3D02G364000.1 | TaLYK1-3D | 3D | 477895788 | 477898692 | + | 615 | 10 | SP | 2 | 6.3 | 67.9702 | −0.018 |
TraesCS3A02G370900.1 | TaLYK1-3A | 3A | 621230384 | 621233286 | + | 612 | 10 | SP | 1 | 5.91 | 67.83787 | −0.058 |
TraesCS6B02G266500.1 | TaLYK2-6B | 6B | 479077207 | 479083290 | − | 716 | 2 | OTHER | 1 | 7 | 76.6752 | −0.140 |
TraesCS6D02G240100.1 | TaLYK2-6D | 6D | 341194264 | 341198640 | + | 714 | 2 | OTHER | 0 | 7.87 | 76.43803 | −0.112 |
TraesCS6A02G258900.1 | TaLYK2-6A | 6A | 481255757 | 481260121 | + | 648 | 2 | SP | 0 | 6.12 | 69.41229 | −0.004 |
TraesCS7D02G056600.1 | TaLYK4-7D | 7D | 30264305 | 30266686 | + | 652 | 1 | SP | 2 | 5.53 | 69.98053 | 0.087 |
TraesCS4A02G427200.1 | TaLYK4-4A | 4A | 698169121 | 698172179 | − | 749 | 2 | OTHER | 0 | 5.45 | 80.56417 | −0.009 |
TraesCS7A02G061600.1 | TaLYK4-7A | 7A | 30651156 | 30653078 | + | 640 | 1 | SP | 1 | 4.89 | 68.03837 | 0.140 |
TraesCS6A02G168800.1 | TaLYK6-6A | 6A | 175995613 | 176003026 | − | 603 | 2 | SP | 1 | 9.05 | 63.48015 | −0.037 |
TraesCS6D02G157800.1 | TaLYK6-6D1 | 6D | 134335551 | 134337568 | − | 637 | 2 | SP | 3 | 8.13 | 67.49872 | 0.015 |
TraesCS6D02G158300.1 | TaLYK6-6D2 | 6D | 134740207 | 134742719 | − | 670 | 1 | SP | 3 | 8.46 | 70.89443 | −0.005 |
TraesCS6B02G196800.1 | TaLYK6-6B | 6B | 233086725 | 233089297 | − | 670 | 1 | SP | 3 | 8.46 | 71.05764 | −0.012 |
TraesCS6B02G197000.1 | TaLYK5-6B | 6B | 233671844 | 233674217 | − | 681 | 1 | SP | 1 | 8.14 | 71.9735 | −0.032 |
TraesCS6A02G168900.1 | TaLYK5-6A | 6A | 176291828 | 176294160 | − | 681 | 1 | SP | 1 | 7.9 | 71.89042 | −0.029 |
TraesCS6D02G157900.1 | TaLYK5-6D1 | 6D | 134586113 | 134588583 | − | 681 | 1 | SP | 1 | 8.31 | 71.70018 | −0.013 |
TraesCS6D02G158400.1 | TaLYK5-6D2 | 6D | 135039466 | 135041947 | − | 681 | 1 | SP | 1 | 7.88 | 71.6431 | −0.001 |
Notes: 1Chromosome location; 2,3Genomic location; 4Prot: protein length; aa: amino acid; 5TargetP: TargetP-2.0 server predicts the presence of N-terminal presequences: signal peptide (SP), thylakoid luminal transit peptide (luTP); 6TMH: TMHMM 2.0 server predicts the presence of transmembrane helices; 7pI: isoelectric point; 8MW: molecular weight; 9GRAVY: grand average of hydropathy value.
In order to classify the LYP genes, phylogenetic analyses were performed and the domains contained in these LYPs were considered simultaneously (
The characteristics of the wheat LYPs are shown in
To analyze the phylogenetic relationships of LYPs from different species, lysin motif contained protein sequences from
The amount of group numbers was calculated for each species. Rice, Arabidopsis and Brachypodium, despite their phylogenetic distance, have a similar number of LYP genes (15, 11 and 13, respectively) (
We found that 62 TaLYPs were localized on chromosomes (1A, 1B, 1D, 3A, 3B, 3D, 4A, 4B, 4D, 5A, 5B, 5D, 6A, 6B, 6D, 7A, 7B, 7D) and the unassembled scaffolds (Un). No gene was located on chromosome 2A, 2B and 2C (
In genetics, Ka/Ks represent the ratio between the nonsynonymous substitution rate (Ka) and the synonymous substitution rate (Ks) of two protein-coding genes. The value of Ka/Ks can be used as an indicator of selective pressure on a protein-coding gene. The Ka/Ks ratio was less than one almost in all gene pairs. The EMSA group showed relatively high Ka/Ks ratio, suggesting that these genes evolved at a faster evolutionary rate, which is a feature of new genes (
8.39% of LYP genes triads across the three subgenomes were comply with 1:1:1. The percentage of LYP genes with homolog-specific duplication is much higher than in all wheat genes (32.26%
Homologous group (A:B:D) | All wheat genes (%)1 | Gene number of LYPs | Composition of genes (%) |
---|---|---|---|
1:1:1 | 35.8 | 30 | 48.39 |
n:1:1/1:n:1/1:1:n2 | 5.76 | 20 | 32.26 |
0:1:1/1:0:1/1:1:0 | 13.22 | 2 | 3.23 |
Other ratio | 8 | 9 | 14.52 |
Orphans/singletons | 37.22 | 1 | 1.61 |
100 | 62 | 100 |
Notes: 1According to IWGSC (2018); 2
36 genes (58%) of the 62 genes were expressed in at least one developmental stage (based on the >0.5 TPM criteria). The remaining 26 genes which tpm <0.5 were considered not expressed. The
We also analyzed the expression pattern of each triad.
We also analyzed the expression pattern of wheat
Except for the genes not expressed, most of the wheat LYK family members were upregulated in response to biotic and abiotic stress. Interestingly, the expression of
The expression levels of
We further used qRT-PCR analysis to investigate the expression of selected genes in response to wheat leaf rust. The selected four genes were upregulated during wheat leaf rust infection with similar expression patterns. The expression of
LYP genes have been widely studied in a range of plants, including monocots and dicots [
Meanwhile, we analyzed the expression pattern of LYP genes during wheat development. Previous study showed that OsEMSA1 appeared in QTL for panicle, seeds, and sterility but not in any other QTL for morphological/physiological traits or QTL for tolerance/resistance [
To verify whether wheat LYPs were involved in the biotic and abiotic reaction, we analyzed the expression pattern by using the RNA-seq data from Wheat Expression Browser. Except for the genes not expressed, most of the wheat LYK family members were upregulated in response to biotic and abiotic stress. Different from other LYK family members which contain the protein kinase domain (Pfam ID: PF00069), wheat LYK5 and LYK6 proteins have the protein tyrosine and serine/threonine kinase domain (Pfam ID: PF07714). Wheat LYK5 and LYK6 were resided in the same clade with AtLYK4 and BdLYK4. No rice homologs were found in this clade. Meanwhile, wheat LYK5 and LYK6 genes derived from tandem duplications and were important contributors to the expansion of LYK gene family. Previous reports have shown that Arabidopsis AtLYK4 is important for chitin recognition during fungal infection [
In this study, TaLYP2 was induced by both fungal infection and PAMPs triggered treatment. TaLYP2 was rice OsCEBiP homolog in wheat. Similar to OsCEBiP, TaLYP2 were predicted to be secreted proteins with no transmembrane helices. OsCEBiP binds chitin oligosaccharides with the extracellular region and forms a complex with OsCERK1 to induce immune signaling [
In summary, our studies provide the phylogeny and diversification of LYPs in wheat, including the evolutionary relationship, synteny analyze and the expression patterns. All of the 62 TaLYPs were divided into 6 subgroups. The LysMe and LYK subgroup were expanded during evolution. The expression of some
Primer | Sequence (5′ to 3′) |
---|---|
TaLysMFbox-qRT-F | AGGCAAAGCAAACGGATTCTC |
TaLysMFbox-qRT-R | TTGTCGCTGCTCCCACCTAA |
TaLysMn1-qRT-F | CGCTGTCCGACGAGTTCTA |
TaLysMn1-qRT-R | CCGTACTTGATGGCGATGC |
TaLYK6-qRT-F | CACTCTGCTAATCCCGCTCAA |
TaLYK6-qRT-R | GCAAGAACACCGACACCAACA |
TaLYK5-qRT-F | TACCTCCTCAACACCACCC |
TaLYK5-qRT-R | CGACGAGTTTGCGGCTAT |
TaGADPH-F | CTGCATCATACGATGACATC |
TaGADPH-R | TGTCACCGACAAAGTCAGTG |
Gene-ID | Name | splice variant | number of splice variants | Pfam-IDs1 | Location | Pfam-IDs2 | Location | Pfam-IDs3 | Location |
---|---|---|---|---|---|---|---|---|---|
TraesCS4B02G353400.1 | TaEMSA1-4B | 1 | 1 | PF01476 | 71–113 | ||||
TraesCS4D02G347400.1 | TaEMSA1-4D | 1 | 1 | PF01476 | 69–111 | ||||
TraesCS1A02G187700.1 | TaEMSA2-1A | 1 | 1 | PF01476 | 66–108 | ||||
TraesCS1B02G195500.1 | TaEMSA2-1B | 1 | 1 | PF01476 | 65—107 | ||||
TraesCS1D02G188900.1 | TaEMSA2-1D | 1 | 1 | PF01476 | 66–108 | ||||
TraesCS3A02G370900.1 | TaLYK1-3A | 1 | 1 | PF01476 | 162–206 | PF00069 | 308–583 | ||
TraesCS3B02G403100.1 | TaLYK1-3B | 1 | 1 | PF01476 | 165–209 | PF00069 | 311–586 | ||
TraesCS3D02G364000.1 | TaLYK1-3D | 1 | 1 | PF01476 | 165–209 | PF00069 | 311–586 | ||
TraesCS6A02G258900.1 | TaLYK2-6A | 1 | 1 | PF01476 | 185–220 | PF00069 | 368–621 | ||
TraesCS6B02G266500.1 | TaLYK2-6B | 1 | 1 | PF01476 | 251–286 | PF00069 | 434–689 | ||
TraesCS6D02G240100.1 | TaLYK2-6D | 1 | 1 | PF01476 | 252–287 | PF00069 | 432–687 | ||
TraesCS3B02G588200.1 | TaLYK3-3B | 1 | 1 | PF01476 | 151–195 | PF00069 | 282–554 | ||
TraesCS5A02G552200.1 | TaLYK3-5A | 1 | 1 | PF01476 | 150–194 | PF00069 | 282–554 | ||
TraesCSU02G125700.1 | TaLYK3-U | 1 | 1 | PF01476 | 151–195 | PF00069 | 239–511 | ||
TraesCS4A02G427200.1 | TaLYK4-4A | 1 | 1 | PF01476 | 211–257 | PF01476 | 284–321 | PF00069 | 441–725 |
TraesCS7A02G061600.1 | TaLYK4-7A | 1 | 1 | PF01476 | 193–233 | PF00069 | 352–630 | ||
TraesCS7D02G056600.1 | TaLYK4-7D | 1 | 1 | PF01476 | 210–247 | PF00069 | 363–580 | ||
TraesCS6A02G168900.1 | TaLYK5-6A | 1 | 1 | PF01476 | 205–248 | PF07714 | 404–656 | ||
TraesCS6B02G197000.1 | TaLYK5-6B | 1 | 1 | PF01476 | 205–248 | PF07714 | 403–656 | ||
TraesCS6D02G157900.1 | TaLYK5-6D1 | 1 | 1 | PF01476 | 205–248 | PF07714 | 384–656 | ||
TraesCS6D02G158400.1 | TaLYK5-6D2 | 1 | 1 | PF01476 | 205–248 | PF07714 | 394–656 | ||
TraesCS6A02G168800.1 | TaLYK6-6A | 1 | 1 | PF01476 | 124–167 | PF07714 | 303–510 | ||
TraesCS6B02G196800.1 | TaLYK6-6B | 1 | 1 | PF01476 | 198–241 | PF07714 | 394–645 | ||
TraesCS6D02G157800.1 | TaLYK6-6D1 | 1 | 1 | PF01476 | 200–243 | PF07714 | 373–612 | ||
TraesCS6D02G158300.1 | TaLYK6-6D2 | 1 | 1 | PF01476 | 198–241 | PF07714 | 397–645 | ||
TraesCS5A02G347800.1 | TaLYP1-5A | 1 | 1 | PF01476 | 110–156 | PF01476 | 174–217 | ||
TraesCS5B02G348800.1 | TaLYP1-5B | 1 | 1 | PF01476 | 110–156 | PF01476 | 174–217 | ||
TraesCS5D02G354000.1 | TaLYP1-5D | 1 | 1 | PF01476 | 114–160 | PF01476 | 178–221 | ||
TraesCS4B02G329500.2 | TaLYP2-4B | 3 | 2 | PF01476 | 109–155 | PF01476 | 174–217 | ||
TraesCS4D02G326400.2 | TaLYP2-4D | 2 | 2 | PF01476 | 115–161 | PF01476 | 180–223 | ||
TraesCS5A02G501100.1 | TaLYP2-5A | 1 | 1 | PF01476 | 174–220 | PF01476 | 238–281 | ||
TraesCS5A02G234700.1 | TaLYP3-5A | 1 | 1 | PF01476 | 116–164 | PF01476 | 184–226 | ||
TraesCS5B02G233200.1 | TaLYP3-5B | 1 | 1 | PF01476 | 116–163 | PF01476 | 183–225 | ||
TraesCS5D02G241600.1 | TaLYP3-5D | 1 | 1 | PF01476 | 110–159 | PF01476 | 179–221 | ||
TraesCS7A02G168500.1 | TaLYP4-7A | 1 | 1 | PF01476 | 109–158 | PF01476 | 178–220 | ||
TraesCS7B02G073300.1 | TaLYP4-7B | 1 | 1 | PF01476 | 109–158 | PF01476 | 178–220 | ||
TraesCS7D02G169400.1 | TaLYP4-7D | 1 | 1 | PF01476 | 109–158 | PF01476 | 178–220 | ||
TraesCS6A02G328800.1 | TaLYP5-6A | 1 | 1 | PF01476 | 216–258 | ||||
TraesCS6B02G359500.1 | TaLYP5-6B1 | 1 | 1 | PF01476 | 176–218 | ||||
TraesCS6B02G359300.1 | TaLYP5-6B2 | 1 | 1 | PF01476 | 176–218 | ||||
TraesCS6D02G307700.1 | TaLYP5-6D | 1 | 1 | PF01476 | 179–221 | ||||
TraesCS3B02G352100.1 | TaLysMe1-3B1 | 1 | 1 | PF01476 | 55–97 | ||||
TraesCS3B02G351900.1 | TaLysMe1-3B2 | 1 | 1 | PF01476 | 55–97 | ||||
TraesCS3D02G316500.1 | TaLysMe1-3D | 1 | 1 | PF01476 | 56–98 | ||||
TraesCS3A02G314900.1 | TaLysMe2-3A | 1 | 1 | PF01476 | 57–99 | ||||
TraesCS3A02G315000.1 | TaLysMe3-3A1 | 1 | 1 | PF01476 | 56–98 | ||||
TraesCS3A02G314800.1 | TaLysMe3-3A2 | 1 | 1 | PF01476 | 55–97 | ||||
TraesCS3B02G352200.1 | TaLysMe3-3B | 1 | 1 | PF01476 | 56–98 | ||||
TraesCS3D02G316600.1 | TaLysMe3-3D | 1 | 1 | PF01476 | 56–98 | ||||
TraesCS3A02G316000.1 | TaLysMe4-3A | 1 | 1 | PF01476 | 55–97 | ||||
TraesCS3B02G350900.1 | TaLysMe4-3B | 1 | 1 | PF01476 | 55–97 | ||||
TraesCS3D02G315500.1 | TaLysMe4-3D1 | 1 | 1 | PF01476 | 58–100 | ||||
TraesCS3D02G315400.1 | TaLysMe4-3D2 | 1 | 1 | PF01476 | 55–97 | ||||
TraesCS3A02G316100.1 | TaLysMe5-3A | 1 | 1 | PF01476 | 79–120 | ||||
TraesCS3B02G350800.1 | TaLysMe5-3B | 1 | 1 | PF01476 | 54–96 | ||||
TraesCS3D02G315300.1 | TaLysMe5-3D | 1 | 1 | PF01476 | 79–121 | ||||
TraesCS4A02G275700.1 | TaLysMFbox-4A | 1 | 1 | PF01476 | 106–149 | PF00646 | 29–71 | ||
TraesCS4B02G038000.1 | TaLysMFbox-4B | 1 | 1 | PF01476 | 103–146 | PF00646 | 29–68 | ||
TraesCS4D02G035300.1 | TaLysMFbox-4D | 1 | 1 | PF01476 | 103–146 | PF00646 | 27–68 | ||
TraesCS7A02G560400.1 | TaLysMn1-7A | 1 | 1 | PF01476 | 51–94 | ||||
TraesCS7B02G486800.1 | TaLysMn1-7B | 1 | 1 | PF01476 | 55–98 | ||||
TraesCS7D02G549400.1 | TaLysMn1-7D | 1 | 1 | PF01476 | 51–94 | ||||
TraesCS4B02G329500.1 | 3 | 1 | PF01476 | 109–155 | PF01476 | 174–217 | |||
TraesCS4B02G329500.3 | 3 | 3 | PF01476 | 109–155 | PF01476 | 174–217 | |||
TraesCS4D02G326400.1 | 1 | 1 | PF01476 | 115–161 | PF01476 | 180–223 |