Brassinosteroids participate in many physiological processes in plants; however, their regulatory roles on the activities of the enzymes involved in dark phase of photosynthesis remains elusive. In this study, detached leaves and protoplasts of maize seedlings were treated with epi-brassinolide (EBR) and brassinazole followed by the determination of the contents of chlorophyll (a+b) and soluble sugars, and the activity of dark reaction enzymes and the expression of the relevant genes. The results showed that chlorophyll (a+b) content increased by 7.4% under 0.1 μM EBR treatment for 48 h; furthermore, chlorophyll (a+b) content increased by 34% in detached leaves that were continuously soaked in brassinazole. In addition, the transcription levels of
Photosynthesis is an important process for generating energy and providing organic materials to plants. Photosynthesis depends on light intensity, light energy conversion, and carbon assimilation [
Brassinosteroids (BRs), a type of sterols, are essential hormones in plants. More than 70 BRs have been found, and these are widely present in the pollen, fruit, seeds, leaves, roots, and stems of plants [
Maize (
Maize inbred line Mo17 was provided by Sichuan Agricultural University, China. Maize seeds were sown in soil, with a ratio of vermiculite to peat soil 1:1 (v/v), and cultivated in a smart light incubator (MGC-250H, Shengyuan Instrument, China), with a light/dark cycle of 16 h/8 h and light intensity of 3,000 lx. The day/night temperature was 25°C/23°C. Maize seedlings with two leaves and one cob were selected for the experiment.
The leaves were cut into 1 cm long leaf segments, and after mixing, divided into three groups, each with six samples, with each sample containing 2 g (fresh weight) of leaf material. Different samples were cultured in medium supplemented with 1 mL distilled water, 4 μM BRZ (Solarbio, Beijing, China) or different concentrations of EBR (Solarbio). The EBR concentration was set to 0.02, 0.05, 0.1, 0.2, 0.5, and 1.0 μM, and the different groups were placed in an incubator for 6 h, 12 h, and 24 h. The second leaf of the two-leaf one-cob maize seedling was digested using cellulase and macerozyme to obtain protoplasts [
Leaves from similar positions were selected and cut into thin strips (2.3079 cm2) that were soaked in 10 mL of a mixture containing acetone and ethanol at a ratio of 2:1 (v/v) at 25°C for 24 h until the strips turned white [
The soluble sugar content in leaves was determined using the phenol-sulfuric acid method [
After the sample was ground in liquid nitrogen, TRIzol reagent (TIANGEN, Beijing, China) and chloroform were added. The sample was then centrifuged and the water phase was taken. Total RNA was extracted used TRIzol reagent. The PrimeScript™ RT reagent kit with gDNA Eraser (Takara, Japan) was used for RT-PCR. TB Green® Premix Ex Taq™ II (Takara, Japan) was added to cDNA, and the RT-qPCR reaction was conducted using the CFX96 Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA).
Gene name | Forward primer (5´-3´) | Reverse primer (5´-3´) | Gene ID |
---|---|---|---|
TCACTACGACTGCCGAGCGAG | GAGCCACCACTGAGGACAACATTAC | 100282267 | |
ATATCTTGGCAGCATTCCGAGTA | TGGTAAGTCCATCAGTCCAAACAG | 845212 | |
GATACCCTGCCTCGAGTTCA | CTCCTGCAGCTCCTTGTACA | 100279574 | |
CTCTTGGAGTACGGACACATGCT | CAGTCTTCATGGCGTCCTCGT | 541712 | |
GCCAAGGACATCACTGACGA | GCGCAAGAACTTAGGCACAC | 542372 | |
AGCCAGCCTGATGGTTCAAA | ACCCATCCCCCTCCAGATAG | 541986 | |
GCGAGGAGCAAAAGAAGCTG | AACAGACGCAGTACTTCCCG | 100284739 | |
TCAATGCCGACCAGTACAAC | CCTTGATGATGCCGAACTTTTG | 542368 | |
CTACGGAGGGATCTACGGGT | AGAATTCTCTGGTGGCCGTC | 100216767 |
Quantification of mRNA was based on the method described by Livak et al. [
The 1 g leaf samples treated with 0, 0.02, 0.1, 0.5, 1.0 μM EBR and 4 μM BRZ, respectively, were fully ground in liquid nitrogen, added to pre-cooled PBS buffer (pH 7.4), and centrifuged at 8,000 rpm for 30 min, after which the supernatant was tested using an ELISA kit (Mskbio, Hunan, China). The supernatant and HRP-labeled detection antibody were added to the coated microwells pre-coated with enzyme capture antibody, incubated, and washed thoroughly. The color was developed with the use of the substrate tetramethylbenzidine (TMB). An enzyme-labeled instrument (Thermo Fisher Scientific, Waltham, MA, USA) was used to determine the absorbance of standard products and samples at 450 nm in order to calculate the content and activity of dark reaction enzymes in the samples.
The data represent the means of three biological replicates. The significance analysis between different treatments was performed using the Tukey’s test using the statistical software Statistical Product and Service Solutions (SPSS).
Treatment with exogenous EBR at 0.05, 0.2, and 0.5 μM for 24 h significantly increased the chlorophyll a and chlorophyll (a+b) content as compared to those in the control, whereas the exogenous BRZ treatment for 24 h significantly reduced the chlorophyll a content (
Leaf |
Time | Treatment | Chl a content (mg·cm-2) | Chl b content (mg·cm-2) | Chl a+b (mg·cm-2) |
---|---|---|---|---|---|
Living | 24 h | BRZ | 1.36 ± 0.13c | 0.72 ± 0.04ab | 2.08 ± 0.02d |
Control | 1.61 ± 0.01a | 0.67 ± 0.06ac | 2.28 ± 0.07a | ||
0.05 μM EBR | 1.84 ± 0.03b | 0.60 ± 0.02c | 2.44 ± 0.02bc | ||
0.10 μM EBR | 1.61 ± 0.04a | 0.72 ± 0.03ab | 2.33 ± 0.04ab | ||
0.20 μM EBR | 1.87 ± 0.03b | 0.63 ± 0.02ac | 2.50 ± 0.06c | ||
0.50 μM EBR | 1.65 ± 0.04a | 0.79 ± 0.03b | 2.45 ± 0.06bc | ||
48 h | BRZ | 1.74 ± 0.02ab | 0.60 ± 0.06a | 2.34 ± 0.06c | |
Control | 1.80 ± 0.13abc | 0.62 ± 0.12a | 2.42 ± 0.13ac | ||
0.05 μM EBR | 1.74 ± 0.02a | 0.71 ± 0.02a | 2.44 ± 0.07abc | ||
0.10 μM EBR | 1.94 ± 0.01c | 0.66 ± 0.00a | 2.60 ± 0.01b | ||
0.20 μM EBR | 1.89 ± 0.04bc | 0.66 ± 0.01a | 2.55 ± 0.01ab | ||
0.50 μM EBR | 1.90 ± 0.02c | 0.64 ± 0.05a | 2.54 ± 0.01ab | ||
Detached | 6 h | BRZ | 1.84 ± 0.02b | 0.60 ± 0.02b | 2.44 ± 0.04b |
Control | 1.72 ± 0.06a | 0.54 ± 0.01ab | 2.26 ± 0.05a | ||
0.02 μM EBR | 1.76 ± 0.42abc | 0.57 ± 0.11ab | 2.33 ± 0.53abc | ||
0.05 μM EBR | 1.75 ± 0.03ab | 0.56 ± 0.05ab | 2.31 ± 0.02a | ||
0.10 μM EBR | 1.68 ± 0.15abc | 0.55 ± 0.05ab | 2.23 ± 0.21abc | ||
0.20 μM EBR | 1.54 ± 0.03c | 0.48 ± 0.04a | 2.02 ± 0.05c | ||
0.50 μM EBR | 1.58 ± 0.21abc | 0.48 ± 0.05ab | 2.07 ± 0.26abc | ||
12 h | BRZ | 2.38 ± 0.04b | 0.79 ± 0.05c | 3.51 ± 0.03b | |
Control | 1.99 ± 0.42a | 0.63 ± 0.11ab | 2.62 ± 0.53a | ||
0.02 μM EBR | 2.08 ± 0.11a | 0.64 ± 0.05abc | 2.72 ± 0.15a | ||
0.05 μM EBR | 2.20 ± 0.02a | 0.66 ± 0.02abc | 2.86 ± 0.04a | ||
0.10 μM EBR | 2.15 ± 0.15a | 0.73 ± 0.06bc | 2.88 ± 0.21ab | ||
0.20 μM EBR | 1.95 ± 0.01a | 0.61 ± 0.04ab | 2.56 ± 0.04a | ||
0.50 μM EBR | 2.05 ± 0.14a | 0.57 ± 0.01a | 2.62 ± 0.15a | ||
24 h | BRZ | 2.29 ± 0.01c | 0.77 ± 0.10c | 3.05 ± 0.10c | |
Control | 1.56 ± 0.09a | 0.55 ± 0.03ab | 2.11 ± 0.12a | ||
0.02 μM EBR | 1.59 ± 0.04a | 0.58 ± 0.01ab | 2.17 ± 0.05a | ||
0.05 μM EBR | 1.56 ± 0.02a | 0.54 ± 0.01ab | 2.10 ± 0.02ad | ||
0.10 μM EBR | 1.39 ± 0.04d | 0.49 ± 0.01a | 1.88 ± 0.05d | ||
0.20 μM EBR | 1.78 ± 0.04b | 0.61 ± 0.01b | 2.39 ± 0.05b | ||
0.50 μM EBR | 1.48 ± 0.08ad | 0.53 ± 0.03ab | 2.01 ± 0.10ad |
With increasing EBR concentration, the soluble sugar content of maize seedlings treated with 0.1, 0.2, and 0.5 μM EBR for 24 h were 35.4%, 32%, and 36.9% higher, respectively, than that in the control group. With the extension of the treatment time, the soluble sugar content significantly increased after treatment with 0.1 μM EBR (
In order to understand the regulatory effect of EBR on the carbon-fixation reaction of plants in different forms, we analyzed the effect of different concentrations of EBR on the expression of enzymes related to the carbon-fixation reaction in maize seedlings. After 24 h of spraying maize seedlings with 0.1 μM EBR, the transcription levels of
To understand the effect of short-term continuous treatment with a small amount of EBR on the dark reaction of detached maize leaves, the expression levels of the enzyme coding genes was determined. The transcription levels of
Plants were treated with BRZ in order to understand the effect of inhibition of EBR synthesis on the dark reaction. After 24 h of BRZ treatment, maize seedlings showed a reduced expression of
Studies have shown that BRs can influence the enzyme activity of carbon fixation in a variety of plants [
Chlorophyll is a photosynthetic pigment that converts photons into electrons. BRs affect chlorophyll synthesis, and mutations in biosynthesis genes negatively regulate chlorophyll synthesis and affect crop yield [
Photosynthesis is related to the production of carbohydrates, and the transportation of sugars affects maize yield [
In the dark reaction, Rubisco determines the net photosynthetic rate of plants, and it is the key enzyme catalyzing the initial steps of CO2 fixation and photorespiration. Rubisco activity can be activated by RCA, the expression of which affects maize yield [
In addition, we compared the changes in gene expression and activity of carbon fixation-related enzymes after treatment with different concentrations of EBR in living maize leaves and found that although gene expression, protein content, and enzyme activity are clearly regulated by EBR, but the trends are inconsistent. This inconsistency was attributed to the fact that the abundance of the transcript itself was not always sufficient to predict protein levels [
The results of our study demonstrate that a lower concentration of EBR can affect the chlorophyll and soluble sugar content and the expression of dark-reaction enzymes in maize seedlings. The transcription level of dark-reaction enzymes steadily increased by 40% to 100% under 0.1 μM EBR treatment, in which soluble sugar content was elevated by 33%. Conversely, BRZ can affect the content of chlorophyll and inhibit the expression of certain genes, but the inhibition of enzyme activity was not obvious. It was also shown that EBR can regulate gene expression in different forms of maize leaves, such as
The authors would like to thank Hui Li for his assistance.