The Warburg effect is considered as a hallmark of various types of cancers, while the regulatory mechanism is poorly understood. Our previous study demonstrated that miR-194-5p directly targets and regulates insulin-like growth factor1 receptor (IGF1R). In this study, we aimed to investigate the role of miR-194-5p in the regulation of the Warburg effect in ovarian cancer cells.
The stable ovarian cell lines with miR-194-5p overexpression or silencing IGF1R expression were established by lentivirus infection. ATP generation, glucose uptake, lactate production and extracellular acidification rate (ECAR) assay were used to analyze the effects of aerobic glycolysis in ovarian cancer cells. Gene expression was analyzed by quantitative polymerase chain reaction (qPCR) and western blot. Immunohistochemistry assays were performed to assess the expression of the IGF1R protein in ovarian cancer tissues.
Overexpression of miR-194-5p or silencing IGF1R expression in ovarian cancer cells decreases ATP generation, glucose uptake, lactate production, and ECAR and inhibits both the mRNA and protein expression of PKM2, LDHA, GLUT1, and GLUT3. While the knockdown of miR-194-5p expression led to opposite results. Overexpression of miR-194-5p or silencing IGF1R expression suppressed the phosphatidylinositol-3-kinase/protein kinase B (PI3K/AKT) pathway, whose activation can sustain aerobic glycolysis in cancer cells, and the knockdown of miR-194-5p expression promoted the activation of the PI3K/AKT pathway.
Our results suggest that miR-194-5p can inhibit the Warburg effect by negative regulation of IGF1R and further repression of the PI3K/AKT pathway, which provides a theoretical basis for further test of miR-194-5p as a target in the treatment of ovarian cancer.
Ovarian cancer is a highly malignant tumor and is the number one killer among cancers of the female reproductive system that seriously threatens the health of women (
Tumor cells rely on abnormal energy metabolism to promote rapid cell growth, invasion, and metastasis. Aerobic glycolysis is the common energy metabolic feature of cancer cells, and cancer cells provide energy by enhancing anaerobic fermentation (
MicroRNAs (miRNAs) are endogenous short RNA of 20 to 24 nucleotides long that are widely expressed in eukaryotes and can induce the degradation of target mRNA or inhibit its translation by complementary pairing with target mRNA (
In our study, we discovered that miR-194-5p affects the aerobic glycolysis of ovarian cancer cells, by which miR-194-5p suppresses aerobic glycolysis via the IGF1R/PI3K/AKT axis. Our finding would provide a rationale for screening the new molecular target of ovarian cancer.
Two human ovarian cancer cell lines, ES-2 and SKOV3, were cultured as previously described (
ES-2 and SKOV3 cells were seeded in a six-well plate overnight and infected with lentiviruses expressing LV-miR-194-5p or LV-miR-194-5p-NC, LV-miR-194-5p-inhibition or LV-miR-194-5p-inhibition-NC, LV-IGF1R-RNAi or LV-IGF1R-RNAi-NC (GeneChem, Shanghai, China). After 72 h of infection, the cells were selected with 2 μg/mL puromycin for two weeks to establish stable cell lines.
Total RNA was extracted using RNA Easy Fast Tissue/Cell Kit (TianGen, Beijing, China), followed by reverse transcription into cDNA using PrimeScript™ RT reagent Kit (Takara, Dalian, China). TB Green® Premix Ex Taq™ II (Takara, Dalian, China) was used to run qPCR. The primer sequences (listed in
Gene | Primer sequence (5′-3′) |
---|---|
Forward: ACACTCCAGCTGGGTGTAACAGCAACTCCA |
|
Forward: CTCGCTTCGGAGCACATATACT |
|
Forward: ACTGGCATCATCTGTACCATTG |
|
Forward: AGGTGATCAAACTCAAAGGCTA |
|
Forward: CTCCTGGTGATGCTTAGTGCCTTG |
|
Forward: TTCAATGCTGATTGTCAACCTG |
|
Forward: CCTGGCACCCAGCACAAT |
The cells were lysed and separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The protein was transferred to a polyvinylidene fluoride membrane and blocked using a blocking buffer. Then, the membranes were incubated with monoclonal primary antibodies respectively, including anti-insulin-like growth factor1 receptor (IGF1R; CST, USA), anti-phosphorylation of serine/threonine kinase (p-AKT; S473, CST, USA), anti-AKT (CST, USA) or β-actin (Bioss, Beijing, China). For the detection of the key genes or enzymes involved in glycolysis, we used polyclonal antibodies, including anti-pyruvate kinase M2 (anti-PKM2), anti-lactate dehydrogenase A (anti-LDHA), anti-glucose transporter 1 and 3 (anti-GLUT1, and GLUT3) (Proteintech, Wuhan, China). After washing, the membranes were incubated with horseradish peroxidase-conjugated secondary antibody (Bioss, Beijing, China) and developed using the enhanced chemiluminescence kit (NCM Biotech, Suzhou, China). The signals were captured by Amersham Imager 600 (USA). The intensity of reference gene β-actin served as the loading control.
The paraffin sections of ovarian cancer tissue were soaked in a series of xylene and graded alcohols and incubated in the boiling buffer containing ethylenediaminetetraacetic acid for antigen retrieval. To inhibit endogenous peroxidase, the sections were incubated in 3% H2O2 solution for 8 min and blocked with goat serum. Then the sections were incubated with a primary antibody against IGF1R (Bioss, Beijing, China), followed by incubation with a secondary antibody (Bioss, Beijing, China). After hematoxylin staining, tissue sections were soaked in an alcohol gradient, followed by soaking in xylene. The images were captured by a microscope, and the target signals were quantified by the Image-J software (USA).
The concentration of ATP was examined using the Enhanced ATP Assay Kit (Beyotime, Shanghai, China). Each well of a twelve-well plate was seeded with 8 × 104 cells and lysed for 42 h. The 96-well plate was preincubated with 100 μL ATP assay buffer for 5 min, and 10 μL of supernatants were added for the determination of ATP concentration. The absorbance was read by a multifunctional microplate reader (PerkinElmer, USA) and calculated by substituting the assay values into the standard curve. The linear range of the assay was between 0.1 nM to 10 µM.
Glucose uptake was detected by Glucose Uptake Colorimetric Assay Kit (Biovision, USA). The cells were cultured overnight in a growth medium without serum and 100 μL of Krebs-Ringer-Phosphate-Hepes buffer containing 2% bovine serum albumin for 40 min. The cells were treated with 0.1 mg/mL insulin to activate the glucose transporter and 10 mM 2-deoxy-D-glucose (2-DG) for 20 min separately. To degrade endogenous NAD(P) and denature enzymes, cells were lysed in 90 μL extraction buffer at 90°C for 40 min and cooled down on the ice for 5 min. Then, neutralization buffer (12 mL) was mixed with 38 μl of Mix B and added to each well, and the absorbance was measured at 412 nm at 37°C by the multifunctional microplate reader. The standard glucose uptake curve was plotted using the standard well absorbance value, and then the glucose uptake level was calculated.
The colorimetric lactate kit (Solarbio, Beijing, China) was used to measure lactate concentration. Cells (5 × 106 cells) were lysed in 1 mL of extraction buffer I through ultrasonic disruption and then centrifuged. Supernatants (700 μL) and extraction buffer II (150 μL) were mixed, followed by centrifugation at 10,000 g at 4°C for 10 min. Then, supernatants (10 μL) were mixed with assay buffer for 20 min at 37°C. The absorbance at 570 nm was read by a multifunctional microplate reader. The standard lactate solution curve was obtained by diluting 2.5, 1.25, 0.625, 0.3125, 0.15625, and 0.078 µmol/mL of the lactate standard into the 96-well plate. The linear range of the assay was between 0.05 mM to 20 mM.
Seahorse XF Glycolysis Stress Test Kit (Agilent, USA) was used to examine ECAR. Then, in the XFe24 microplate, (2 × 104) cells were seeded. The cartridge sensor was hydrated overnight in a CO2-free incubator. Before detection with seahorse, the cells were treated with 2 mM glutamine for 1 h in a CO2-free incubator. Glucose (100 mM), oligomycin (100 µM), and 2-DG (500 mM) were added sequentially into each well and detected through Seahorse XFe24 Analyzer (Agilent, USA).
Data from at least three independent experiments were expressed as the mean ± SD. The data were analyzed by SPSS 26.0 software with the two-tailed Student’s
The tumor cells have a higher glucose uptake rate and produce more ATP and lactate than normal cells because of the Warburg effect. To detect the role of miR-194-5p in the Warburg effect in ovarian cancer cells, we established ovarian cancer cells with stable overexpression of miR-194-5p or its knockdown by lentivirus infection (
Many key enzymes or genes of glycolytic metabolism are altered by the Warburg effect. Therefore, we assessed the mRNA and protein expression of PKM2, LDHA, GLUT1, and GLUT3 in ovarian cancer cells when miR-194-5p was overexpressed or its expression was knocked down. PKM2 determines whether glucose is channeled into the lactate-producing pathway. LDHA is a step-controlling enzyme that controls the last step of glycolysis by mediating the interconversion of pyruvate and lactate. GLUT1 and GLUT3 are two important glucose transporters involved in glycolysis in tumor cells (
In our previous studies, we showed that IGF1R is the direct target of miR-194-5p (
IGF1R and its downstream PI3K-AKT pathway serve as important regulators in the energy metabolism in tumor cells (
In recent years, more studies have demonstrated that the Warburg effect plays a vital role in tumor cell progression, metastasis, and chemotherapy resistance (
IGF1R is frequently overexpressed in several tumor types, including ovarian cancer (
In conclusion, the present study revealed the role of miR-194-5p and its target gene, IGF1R, on aerobic glycolysis in ovarian cancer cells. MiR-194-5p suppressed aerobic glycolysis and negatively regulated IGF1R and the PI3K/AKT pathway. IGF1R promotes glycolysis in ovarian cancer cells. Therefore, miR-194-5p regulates aerobic glycolysis of ovarian cancer cells, possibly via IGF1R, which in turn affects the PI3K/AKT signaling pathway, suggesting the potential of miR-194-5p as a target in the treatment of ovarian cancer.
All data generated or analyzed during this study are included in this published article.
Study conception and design: Ru Bai; data collection: Lijun Du and Kaikai Dou; analysis and interpretation of results: Lijun Du, Kaikai Dou, and Nianhai Liang; draft manuscript preparation: Lijun Du, Ru Bai, Jianmin Sun. All authors reviewed the results and approved the final version of the manuscript.
This study was approved by the Ethical Committee of Ningxia Medical University (Protocol No. 2020-007). The use of 25 fixed ovarian cancer tissues and 5 fixed normal ovarian tissues was approved by the Department of Pathology, General Hospital of Ningxia Medical University.
This work was supported by the
The authors declare that they have no conflicts of interest to report regarding the present study.