Recent studies have shown that the microtubule disrupting protein Stathmin 1 (STMN1) is differentially expressed in AML patients and healthy control. The aim of this study was to explore the effects and molecular mechanism of STMN1 in AML. Here, the expression of STMN1 in peripheral blood cells (PBMCs) and bone marrow of AML patients and healthy volunteers was detected by RT-PCR and Western blot. STMN1 expression was regulated by transfected with
As the most common type of acute leukemia, the pathophysiology of acute myeloid leukemia (AML) involves the maturational arrest of bone marrow cells and the activation or inactivation of genes that contribute to genomic instability (
Stathmin 1 (STMN1), also known as oncoprotein 18 (Op18), is a cytosolic protein that mediates microtubule destabilization (
Phosphoinositide 3-kinase (PI3K), Akt (protein kinase B/PKB), and mammalian target of rapamycin (mTOR) all participate in a signaling pathway that mediates many key functions in cells (
pathway is highly related to an up-regulation of Bax expression and activation of Caspase-3 (
Here, we found that STMN1 expression was increased in PBMCs and bone marrow of AML patients and was closely related to FAB subtypes, risk stratification, disease-free survival, and overall survival of AML patients. Functionally, overexpression of STMN1enhanced cell proliferation and reduced cell apoptosis rates of both HL60 and K562 cells. We also found that the PI3K/Akt pathway could be activated by STMN1. When taken together, our data suggest STMN1 as a potential prognostic marker for AML patients and also a promising therapeutic target for AML.
A total of 30 AML patients and 10 volunteers with external spinal injury, and who were diagnosed without AML were enrolled in this study. All the AML patients were diagnosed according to ELN criteria (
Human promyelocytic leukemia HL60 cells and human chronic myelogenic leukemic cells K562 were obtained from the American Type Culture Collection (Manassas, VA, USA) and cultured in RPMI-1640 medium (Thermo Fisher Scientific, Cat. No. A1049101) supplemented with 10% fetal bovine serum (FBS, Thermo Fisher Scientific, Cat. No. 10100147C) at 37°C in an incubator containing 95% air and 5% CO2.
The human
Total RNA was extracted from PBMCs or bone marrow using Trizol reagent (Takara, Cat. No. 9109) according to the manufacturer’s instructions. HL60 and K562 cells (5 × 105) were transfected for 48 h with pcDNA3.1 (vector control), pcDNA-STMN1, pRS Control shRNA (shCTRL) or pRS STMN1 shRNA (shSTMN1) by Lipofectamine 2000, cells were collected and extracted by Trizol reagent. First-strand cDNA was synthesized using Bestar qPCR RT mix (DBI, Cat. No. 220), and the mRNA was amplified by using Bestar qPCR Master Mix kit (DBI, Cat. No. 2043) on an ABI real-time PCR system (7500). The PCR procedure was performed as follows: 95°C for 2 min, followed by 40 cycles of 95°C for 20 s, 60°C for 20 s, and 72°C for 20 s. The specific primers used were GAPDH: (forward) 5’ TGTTCGTCATGGGTGTGAAC3’, (reverse) 5’ ATGGCATGGACTGTGGTCAT 3’; STMN1: (forward) 5’ TCAGCCCTCGGTCAAAAGAAT 3’, (reverse) 5’ TTCTCGTGCTCTCGTTTCTCA 3’. The data were analyzed according to the 2−∆∆Ct method.
HL60 or K562 cells (1 × 104 in 100 μL of culture medium) were seeded into the wells of a 96-well plate and transfected with pcDNA3.1 (vector control), pcDNA-STMN1, pRS Control shRNA (shCTRL) or pRS STMN1 shRNA (shSTMN1) using Lipofectamine 2000. After 24, 48 or 72 h of transfection, 10 µL of CCK-8 solution (Sigma, Cat. No. 96992, 1:10 dilution) was added to each well, and the cells were incubated for another 2 h at 37°C. The absorbance of each well at 450 nm was determined with a microplate reader.
HL60 or K562 cells (2 × 105) were seeded into the wells of a 12-well plate and transiently transfected with pcDNA3.1 (vector control), pcDNA-STMN1, pRS Control shRNA (shCTRL), or pRS STMN1 shRNA (shSTMN1) using Lipofectamine 2000. After 48 h of transfection, the cells were cytocentrifuged onto SuperFrost Plus glass slides at 450 ×
HL60 or K562 cells (5 × 105) were seeded into the wells of a 6-well plate and transiently transfected with pcDNA3.1 (vector control), pcDNA-STMN1, pRS Control shRNA (shCTRL), or pRS STMN1 shRNA (shSTMN1) using Lipofectamine 2000. After 48 h of transfection, the cells were centrifuged at 1000 rpm for 5 min and washed once with PBS. The cells were then fixed in pre-cooled 70% ethanol and stored at −20°C overnight.The nextday, the cells were pelleted by centrifugation, washed once with PBS, and stained with 400 μL of PI/RNase solution (PI: 50 μg/mL, RNase: 100 μg/mL, Cell Signaling Technology, Cat. No. 4087) for 20 min at 37°C in the dark. The cell cycle distribution was determined by flow cytometry.
HL60 or K562 cells (2 × 105) were seeded into the wells of a 12-well plate and transfected with pcDNA3.1 (vector control), pcDNA-STMN1, pRS Control shRNA (shCTRL), or pRS STMN1 shRNA (shSTMN1) using Lipofectamine 2000. After 48 h of transfection, the cells were centrifuged at 1500 ×
Parameters | Number of cases (N = 30) | |
---|---|---|
N | % | |
WHO classification of AML cases | ||
AML with recurrent cytogenetics | ||
AML with t(8;21) | 2 | 6.67 |
AML with inv16 | 2 | 6.67 |
Acute promyelocytic leukemia with PML/RARA | 4 | 13.33 |
AML with t(6;9) | 1 | 3.33 |
AML with bi-allelic mutation of CEPBA | 1 | 3.33 |
AML without maturation | 3 | 10.00 |
AML with maturation | 8 | 26.67 |
Acute myelomonocytic leukemia | 6 | 20.00 |
Acute monoblastic/monocytic leukemia | 2 | 6.67 |
Pure erythroid leukemia | 1 | 3.33 |
Conventional karyotyping | ||
Normal | 25 | 83.34 |
47,xy,+8 | 2 | 6.67 |
47,xy,+9 | 1 | 3.33 |
46,xy,−9 | 1 | 3.33 |
46,xy,t(6:9) | 1 | 3.33 |
Cancer cytogenetics (Fluorescent |
||
Positive | ||
inv16 | 3 | 10.00 |
t(15;17) | 6 | 20.00 |
t(8;21) | 1 | 3.33 |
Negative | 15 | 50.00 |
Not available | 5 | 16.67 |
HL60 or K562 cells (2 × 105) were plated into the wells of a 12-well plate and transiently transfected with pcDNA3.1 (vector control), pcDNA-STMN1, pRS Control shRNA (shCTRL), or pRS STMN1 shRNA (shSTMN1) using Lipofectamine 2000. After 48 h of transfection, the cells were fixed by 4% paraformaldehyde (PFA) and permeabilized with 0.25% Triton X-100. After being washed twice with deionized water, the cells were incubated with DNase I solution for 30 min and then treated with TdT reaction cocktail for 60 min at 37°C. After being washed 3 times with 3% BSA in PBS, the cells were incubated with Click-iT reaction cocktail (Thermo Fisher Scientific, Cat. No. C10338) for 30 min and then washed one tome in 3% BSA dissolved in PBS.
Bone marrow samples collected from patients or healthy control subjects were lysed in RIPA buffer (Sigma, Cat. No.R0278). HL60 or K562 cells were added into the wells of a 6-well plate and transiently transfected with pcDNA3.1 (vector control), pcDNA-STMN1, pRS Control shRNA (shCTRL), or pRS STMN1 shRNA (shSTMN1) using Lipofectamine 2000. After 48 h of transfection, the cells were lysed by RIPA lysis buffer, and the total proteins were extracted. The protein concentration in each extract with determined using a BCA protein assay kit (Sigma, Cat. No. B9643). Next, an equal amount of total protein (20 μg) from each extract was separated by 10% SDS-PAGE, and the protein bands were transferred onto PVDF membrane (Millipore, Cat. No. IPVH00010), which were subsequently blocked with 5% non-fat milk for 1 h. The membranes were then washed with 1 × TBST and incubated with the following antibodies: STMN1 (Novus, Cat. No. NBP1-76798), cyclin B1 (Santa Cruz, Cat. No. sc-245), cyclin D1 (Cell Signaling Technology, Cat. No. 2922), Caspase3 (Cell Signaling Technology, Cat. No. 9662), Bcl-2 (Cell Signaling Technology, Cat. No. 423), Bax (Cell Signaling Technology, Cat. No. 2772), PTEN (Cell Signaling Technology, Cat. No. 9552), AKT (Cell Signaling Technology, Cat. No. 9272), p-AKT (Cell Signaling Technology, Cat. No. 4060), PI3K (Cell Signaling Technology, Cat. No. 4255), p-PI3K (Cell Signaling Technology, Cat. No. 17366), and GAPDH (Cell Signaling Technology, Cat. No. 97166) at 4°C overnight. Next, the membranes were washed three times with 1 × TBST and incubated with an HRP conjugated anti-rabbit (Abcam, Cat. No. ab6721) or anti-mouse (Abcam, Cat. No. ab6728) secondary antibodies. Immunostaining of the target proteins was visualized by enhanced chemiluminescence (Thermo Fisher Scientific, Cat. No. 32106).
All assays were repeated at least three times, and results were shown as a mean value ± standard error of the mean (S.E.M.). All data were analyzed using GraphPad Prism Software (Prism 7.0). Comparisons of normally distributed data between two groups were performed using the Student’s
(A and B) PBMCs (A) or bone marrow samples (B) were collected from 30 patients with AML and 10 healthy control subjects, and the total RNA was extracted for RT-PCR assay. (C) The total proteins were extracted from bone marrow from 30 patients with AML and 10 healthy control subjects, and STMN1 expression was detected by Western blot. GAPDH served as a loading control. ***
Parameters | Group | N | Expression of STMN1 | ||
---|---|---|---|---|---|
High, n (%) | Low, n (%) | ||||
Age (years) | ≤40 | 12 | 7 (58.33) | 5 (41.67) | 0.879 |
>40 | 18 | 11 (61.11) | 7 (38.89) | ||
Gender | Female | 16 | 12 (75.00) | 4 (25.00) | 0.156 |
Male | 14 | 7 (50.00) | 7 (50.00) | ||
FAB subtype | M0–M3 | 8 | 6 (75.00) | 2 (25.00) | |
M3–M7 | 22 | 5 (22.73) | 17 (77.27) | ||
Risk stratification | Good | 8 | 2 (25.00) | 6 (75.00) | |
Intermediate | 14 | 11 (78.57) | 3 (21.43) | ||
Poor | 8 | 7 (87.50) | 1 (12.50) | ||
WBC (×109/L) | – | – | 23.84 ± 11.53 | 20.72 ± 8.47 | 0.634 |
Hb (g/L) | – | – | 81.67 ± 21.36 | 80.26 ± 20.83 | 0.837 |
PLT (×109/L) | – | – | 29 (6–207) | 49 (6–406) | 0.006 |
Note: WBC white blood cell count, Hb hemoglobin, PLT platelet.
The expression of STMN1 in the PBMCs and bone marrow from 30 patients with AML and 10 healthy control was detected, and our analysis showed that the levels of STMN1 mRNA expression were significantly elevated in the PBMCs and bone marrow of AML patients when compared with their levels in healthy control subjects (
We found that STMN1 expression was not related to patient age, sex, or white blood cell (WBC) (
(A and B) The disease-free survival and overall survival times were summarized by survival curves.
(A and B) K562 cells (A) or HL60 cells (B) were seeded into the wells of a 96-well plate and transfected with plasmid. OD450 values were determined at 24, 48, and 72 h post-transfection. (C and D) K562 cells (C) or HL60 cells (D) were transfected with the indicated plasmid were fixed and stained with EdU. The percentage of EdU-positive cells was calculated after examining 20 fields for each group (number of EdU-positive cells/total cells × 100%). Results are based on data obtained from three independent experiments. ***
(A and B) K562 cells (A) or HL60 cells (B) were transfected with the indicated, fixed for PI staining, and analyzed by flow cytometry. Results are based on data obtained from three independent experiments. *
To further examine the effects of STMN1 on AML progression, we used two human leukemia cell lines (K562 and HL60) to clarify the effect of STMN1 on cell proliferation. We found that overexpression of STMN1 induced the proliferation of both K562 and HL60 cells as detected by CCK8 (
Next, we examined the cell cycle distribution induced by STMN1. Overexpression of STMN1 induced G1 phase arrest and suppression of STMN1 accumulations ofthe G2 phase in both K562 and HL60 cells (
These data indicated that overexpression of STMN1 enhanced cell proliferation and suppression of STMN1 reduced cell proliferation. In addition, cells that overexpressed STMN1 were arrested in the G1 phase of cell division, while cells with suppressed levels of STMN1 expression were arrested in the G2/M phase.
Results of Annexin V assays revealed that when compared with control (shCTRL), suppression of STMN1 significantly increased the rate of apoptosis in HL60 and K562 cells from 21.2% to 43.6% and from 15.9% to 33.2%, respectively (early and late apoptosis, the sum of the second and fourth quadrants). We also found that overexpression of STMN1 reduced the apoptosis rate to 50% in both K562 and HL60 cells (
Moreover, we performed TUNEL assays to further confirm the effects of STMN1 on cell apoptosis. As shown in (
To help identify the signal pathway involved in STMN1-induced cell proliferation and apoptosis reduction, we detected the expression of phosphorylated PI3K and Akt. Western blot analysis revealed that STMN1 activated the PI3K/Akt pathway, while inhibition of STMN1 reduced the phosphorylation of PI3K/Akt (
(A and B) K562 cells (A) or HL60 cells (B) were transfected with the indicated plasmid and collected for Annexin V staining. The percentage of apoptotic cells was calculated based on the second and fourth quadrants in the Annexin V assay. Results are based on data obtained from three independent experiments. **
K562 cells (A) or HL60 cells (B) were transfected with the indicated plasmid and fixed for TUENL staining. The respective images are shown.
(A–D) K562 cells or HL60 cells were transfected with the plasmid, and their cellular levels of STMN1, cyclin B1, cyclin D1, Caspase 3, Bcl-2, Bax, PTEN, AKT, p-AKT, p-PI3K, PI3K were determined by Western blot (A and C). GAPDH served as a loading control. The relative levels of expression are based on data obtained from three independent experiments (B and D). A: Control, B: pCDNA, C: pCDNA-STMN1, D: shCTRL, E: shSTMN1. *
We found that STMN1 was more highly expressed in the PBMCs and bone marrow of AML patients than in healthy control subjects. Overexpression of STMN1 induced cell proliferation and reduced cell apoptosis, while suppression of STMN1 inhibited cell proliferation and enhanced cell apoptosis. Furthermore, suppression of STMN1 dysregulated the PI3K/Akt pathway and promoted the cellular expression of Caspases3 and the pro-apoptotic factor Bax, but reduced the levels of the anti-apoptotic factor, Bcl-2. Thus, we showed that STMN1 playedpromotive roles in AML.
STMN1, a phosphoprotein, belongs to the stathmin family of proteins and helps to mediate microtubule dynamics by destabilizing microtubules (
Uncontrolled proliferation is a key hall mark of tumorigenesis. STMN1 plays an essential role in the dynamics of the mitotic spindle, which allows chromosome segregation and cell division (
Escape from apoptosis is an essential step for malignant tumor progression (
The PI3K/Akt pathway is abnormally upregulated in cancers, including AML, and plays an essential role in AML progression (
In conclusion, we found that the levels of STMN1 expression in PBMCs and bone marrow from AML patients were higher than those levels in healthy controls subjects. We also found that a high level of SMTN1 expression was related to shorter disease-free survival and overall survival times. Mechanistically, STMN1 increased the proliferation rate and decreased the apoptosis rate of AML cells by activating the PI3K/Akt pathway. STMN1 might serve as a new prognostic marker or therapeutic target for AML.